FHIR © HL7.org  |  Server Home  |  Health Intersections FHIR Server v1.9.374  |  FHIR Version 4.6.0  | User: ANONYMOUS (Unknown)  

History Record

XML or JSON representation

Links: First Previous Next Last  (17 found). Search: http://test.fhir.org/r5/MolecularSequence/_history?&_prior=2021-06-24T11:44:03.859Z&_format=text/xhtml&history-id=f1b3618b-70fa-4fa2-923c-6247408da3 

MolecularSequence "graphic-example-5" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12watson128273732128273736

{
  "resourceType" : "MolecularSequence",
  "id" : "graphic-example-5",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.719Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000002.12</span></td><td>watson</td><td>128273732</td><td>128273736</td></tr></table></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000002.12"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 128273732,
    "windowEnd" : 128273736
  }
}

MolecularSequence "graphic-example-4" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

ReferenceSeqs

-ChromosomeGenomeBuildStrandWindowStartWindowEnd
*chromosome 2GRCh 38watson128273736128273740

{
  "resourceType" : "MolecularSequence",
  "id" : "graphic-example-4",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.672Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>Chromosome</b></td><td><b>GenomeBuild</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>chromosome 2</span></td><td>GRCh 38</td><td>watson</td><td>128273736</td><td>128273740</td></tr></table></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "referenceSeq" : {
    "chromosome" : {
      "coding" : [
        {
          "system" : "http://terminology.hl7.org/CodeSystem/chromosome-human",
          "code" : "2",
          "display" : "chromosome 2"
        }
      ]
    },
    "genomeBuild" : "GRCh 38",
    "strand" : "watson",
    "windowStart" : 128273736,
    "windowEnd" : 128273740
  }
}

MolecularSequence "graphic-example-3" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqPointerStrandWindowStartWindowEnd
*Generated Summary: type: dna; 0watson128273732128273736

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*1282737234128273736GAAT2M

pointer: Generated Summary: type: dna; 0


{
  "resourceType" : "MolecularSequence",
  "id" : "graphic-example-3",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.613Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqPointer</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><a>Generated Summary: type: dna; 0</a></td><td>watson</td><td>128273732</td><td>128273736</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td><td><b>Cigar</b></td></tr><tr><td>*</td><td>1282737234</td><td>128273736</td><td>GA</td><td>AT</td><td>2M</td></tr></table><p><b>pointer</b>: <a>Generated Summary: type: dna; 0</a></p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "referenceSeq" : {
    "referenceSeqPointer" : {
      "reference" : "MolecularSequence/graphic-example-5"
    },
    "strand" : "watson",
    "windowStart" : 128273732,
    "windowEnd" : 128273736
  },
  "variant" : [
    {
      "start" : 1282737234,
      "end" : 128273736,
      "observedAllele" : "GA",
      "referenceAllele" : "AT",
      "cigar" : "2M"
    }
  ],
  "pointer" : [
    {
      "reference" : "MolecularSequence/graphic-example-4"
    }
  ]
}

MolecularSequence "graphic-example-2" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqStringStrandWindowStartWindowEnd
*CGCCATTGwatson08

pointer: Generated Summary: type: dna; 0


{
  "resourceType" : "MolecularSequence",
  "id" : "graphic-example-2",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.563Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqString</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td>CGCCATTG</td><td>watson</td><td>0</td><td>8</td></tr></table><p><b>pointer</b>: <a>Generated Summary: type: dna; 0</a></p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "referenceSeq" : {
    "referenceSeqString" : "CGCCATTG",
    "strand" : "watson",
    "windowStart" : 0,
    "windowEnd" : 8
  },
  "pointer" : [
    {
      "reference" : "MolecularSequence/graphic-example-3"
    }
  ]
}

MolecularSequence "graphic-example-1" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12watson128273724128273732

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273725128273726GT1M

pointer: Generated Summary: type: dna; 0


{
  "resourceType" : "MolecularSequence",
  "id" : "graphic-example-1",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.516Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000002.12</span></td><td>watson</td><td>128273724</td><td>128273732</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td><td><b>Cigar</b></td></tr><tr><td>*</td><td>128273725</td><td>128273726</td><td>G</td><td>T</td><td>1M</td></tr></table><p><b>pointer</b>: <a>Generated Summary: type: dna; 0</a></p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000002.12"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 128273724,
    "windowEnd" : 128273732
  },
  "variant" : [
    {
      "start" : 128273725,
      "end" : 128273726,
      "observedAllele" : "G",
      "referenceAllele" : "T",
      "cigar" : "1M"
    }
  ],
  "pointer" : [
    {
      "reference" : "MolecularSequence/graphic-example-2"
    }
  ]
}

MolecularSequence "breastcancer" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: rna

coordinateSystem: 0

patient: Patient/brcapat

ReferenceSeqs

-ReferenceSeqIdWindowStartWindowEnd
*Homo sapiens BRCA2, DNA repair associated (BRCA2), mRNA101488058101499444

Variants

-StartEndObservedAlleleReferenceAllele
*3231618632316187AC

{
  "resourceType" : "MolecularSequence",
  "id" : "breastcancer",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.453Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: rna</p><p><b>coordinateSystem</b>: 0</p><p><b>patient</b>: <a>Patient/brcapat</a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>Homo sapiens BRCA2, DNA repair associated (BRCA2), mRNA</span></td><td>101488058</td><td>101499444</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>32316186</td><td>32316187</td><td>A</td><td>C</td></tr></table></div>"
  },
  "type" : "rna",
  "coordinateSystem" : 0,
  "patient" : {
    "reference" : "Patient/brcapat"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore/",
          "code" : "NM_000059.3",
          "display" : "Homo sapiens BRCA2, DNA repair associated (BRCA2), mRNA"
        }
      ]
    },
    "windowStart" : 101488058,
    "windowEnd" : 101499444
  },
  "variant" : [
    {
      "start" : 32316186,
      "end" : 32316187,
      "observedAllele" : "A",
      "referenceAllele" : "C"
    }
  ]
}

MolecularSequence "example-TPMT-two" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 1

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NT_007592.15watson1813091818143955

Variants

-StartEndObservedAlleleReferenceAllele
*1813101218131012TC

observedSeq: T-C-T-C-G-C-C-C


{
  "resourceType" : "MolecularSequence",
  "id" : "example-TPMT-two",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.408Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 1</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NT_007592.15</span></td><td>watson</td><td>18130918</td><td>18143955</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>18131012</td><td>18131012</td><td>T</td><td>C</td></tr></table><p><b>observedSeq</b>: T-C-T-C-G-C-C-C</p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 1,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NT_007592.15"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 18130918,
    "windowEnd" : 18143955
  },
  "variant" : [
    {
      "start" : 18131012,
      "end" : 18131012,
      "observedAllele" : "T",
      "referenceAllele" : "C"
    }
  ],
  "observedSeq" : "T-C-T-C-G-C-C-C"
}

MolecularSequence "example-TPMT-one" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 1

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NT_007592.15watson1813091818143955

Variants

-StartEndObservedAlleleReferenceAllele
*1813921418139214AG

observedSeq: T-C-C-C-A-C-C-C


{
  "resourceType" : "MolecularSequence",
  "id" : "example-TPMT-one",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.344Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 1</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NT_007592.15</span></td><td>watson</td><td>18130918</td><td>18143955</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>18139214</td><td>18139214</td><td>A</td><td>G</td></tr></table><p><b>observedSeq</b>: T-C-C-C-A-C-C-C</p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 1,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NT_007592.15"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 18130918,
    "windowEnd" : 18143955
  },
  "variant" : [
    {
      "start" : 18139214,
      "end" : 18139214,
      "observedAllele" : "A",
      "referenceAllele" : "G"
    }
  ],
  "observedSeq" : "T-C-C-C-A-C-C-C"
}

MolecularSequence "example-pgx-2" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-OrientationReferenceSeqIdStrandWindowStartWindowEnd
*senseNG_007726.3watson5522797055227980

Variants

-StartEndObservedAlleleReferenceAlleleVariantPointer
*5522797855227979GTTarget Haplotype Observation

{
  "resourceType" : "MolecularSequence",
  "id" : "example-pgx-2",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.282Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>Orientation</b></td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td>sense</td><td><span>NG_007726.3</span></td><td>watson</td><td>55227970</td><td>55227980</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td><td><b>VariantPointer</b></td></tr><tr><td>*</td><td>55227978</td><td>55227979</td><td>G</td><td>T</td><td><a>Target Haplotype Observation</a></td></tr></table></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "orientation" : "sense",
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NG_007726.3"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 55227970,
    "windowEnd" : 55227980
  },
  "variant" : [
    {
      "start" : 55227978,
      "end" : 55227979,
      "observedAllele" : "G",
      "referenceAllele" : "T",
      "variantPointer" : {
        "reference" : "Observation/example-haplotype2",
        "display" : "Target Haplotype Observation"
      }
    }
  ]
}

MolecularSequence "example-pgx-1" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-OrientationReferenceSeqIdStrandWindowStartWindowEnd
*senseNG_007726.3watson5522797055227980

Variants

-StartEndObservedAlleleReferenceAlleleVariantPointer
*5522797655227977GTTarget Haplotype Observation

{
  "resourceType" : "MolecularSequence",
  "id" : "example-pgx-1",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.235Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>Orientation</b></td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td>sense</td><td><span>NG_007726.3</span></td><td>watson</td><td>55227970</td><td>55227980</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td><td><b>VariantPointer</b></td></tr><tr><td>*</td><td>55227976</td><td>55227977</td><td>G</td><td>T</td><td><a>Target Haplotype Observation</a></td></tr></table></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "orientation" : "sense",
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NG_007726.3"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 55227970,
    "windowEnd" : 55227980
  },
  "variant" : [
    {
      "start" : 55227976,
      "end" : 55227977,
      "observedAllele" : "G",
      "referenceAllele" : "T",
      "variantPointer" : {
        "reference" : "Observation/example-haplotype1",
        "display" : "Target Haplotype Observation"
      }
    }
  ]
}

MolecularSequence "fda-example" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 1

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000001.11watson10453101770080

Variants

-StartEndObservedAlleleReferenceAllele
*1311613117TG

Qualities

-TypeStandardSequenceStartEndMethodTruthTPQueryTPTruthFNQueryFPGtFPPrecisionRecallFScore
*snpfile-Bk50V4Q0qVb65P0v2VPbfYPZ10453101770080Vcfeval + Hap.py Comparison7749798425541067021860.4280050.7521110.545551

Repositories

-TypeUrlNameVariantsetId
*loginhttps://precision.fda.gov/files/file-Bx37ZK009P4bX5g3qjkFZV38FDAfile-Bx37ZK009P4bX5g3qjkFZV38

{
  "resourceType" : "MolecularSequence",
  "id" : "fda-example",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.188Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 1</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000001.11</span></td><td>watson</td><td>10453</td><td>101770080</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>13116</td><td>13117</td><td>T</td><td>G</td></tr></table><h3>Qualities</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>StandardSequence</b></td><td><b>Start</b></td><td><b>End</b></td><td><b>Method</b></td><td><b>TruthTP</b></td><td><b>QueryTP</b></td><td><b>TruthFN</b></td><td><b>QueryFP</b></td><td><b>GtFP</b></td><td><b>Precision</b></td><td><b>Recall</b></td><td><b>FScore</b></td></tr><tr><td>*</td><td>snp</td><td><span>file-Bk50V4Q0qVb65P0v2VPbfYPZ</span></td><td>10453</td><td>101770080</td><td><span>Vcfeval + Hap.py Comparison</span></td><td>7749</td><td>7984</td><td>2554</td><td>10670</td><td>2186</td><td>0.428005</td><td>0.752111</td><td>0.545551</td></tr></table><h3>Repositories</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>Url</b></td><td><b>Name</b></td><td><b>VariantsetId</b></td></tr><tr><td>*</td><td>login</td><td><a>https://precision.fda.gov/files/file-Bx37ZK009P4bX5g3qjkFZV38</a></td><td>FDA</td><td>file-Bx37ZK009P4bX5g3qjkFZV38</td></tr></table></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 1,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000001.11"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 10453,
    "windowEnd" : 101770080
  },
  "variant" : [
    {
      "start" : 13116,
      "end" : 13117,
      "observedAllele" : "T",
      "referenceAllele" : "G"
    }
  ],
  "quality" : [
    {
      "type" : "snp",
      "standardSequence" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/files/",
            "code" : "file-Bk50V4Q0qVb65P0v2VPbfYPZ"
          }
        ]
      },
      "start" : 10453,
      "end" : 101770080,
      "method" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/jobs/",
            "code" : "job-ByxYPx809jFVy21KJG74Jg3Y"
          }
        ],
        "text" : "Vcfeval + Hap.py Comparison"
      },
      "truthTP" : 7749,
      "queryTP" : 7984,
      "truthFN" : 2554,
      "queryFP" : 10670,
      "gtFP" : 2186,
      "precision" : 0.428005,
      "recall" : 0.752111,
      "fScore" : 0.545551
    }
  ],
  "repository" : [
    {
      "type" : "login",
      "url" : "https://precision.fda.gov/files/file-Bx37ZK009P4bX5g3qjkFZV38",
      "name" : "FDA",
      "variantsetId" : "file-Bx37ZK009P4bX5g3qjkFZV38"
    }
  ]
}

MolecularSequence "fda-vcfeval-comparison" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

coordinateSystem: 1

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000001.11watson10453101770080

Variants

-StartEndObservedAlleleReferenceAllele
*1311613117TG

quality

type: indel

standardSequence: file-BkZxBZ00bpJVk2q6x43b1YBx

start: 10453

end: 101770080

method: Vcfeval + Hap.py Comparison

truthTP: 7749

truthFN: 2554

queryFP: 10670

gtFP: 2186

precision: 0.428005

recall: 0.752111

quality

type: snp

standardSequence: file-BkZxBZ00bpJVk2q6x43b1YBx

start: 10453

end: 101770080

method: Vcfeval + Hap.py Comparison

truthTP: 92106

truthFN: 1247

queryFP: 21744

gtFP: 493

precision: 0.808602

recall: 0.986642

Repositories

-TypeUrlName
*loginhttps://precision.fda.gov/jobs/job-ByxYPx809jFVy21KJG74Jg3YFDA

{
  "resourceType" : "MolecularSequence",
  "id" : "fda-vcfeval-comparison",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.125Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>coordinateSystem</b>: 1</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000001.11</span></td><td>watson</td><td>10453</td><td>101770080</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>13116</td><td>13117</td><td>T</td><td>G</td></tr></table><blockquote><p><b>quality</b></p><p><b>type</b>: indel</p><p><b>standardSequence</b>: <span>file-BkZxBZ00bpJVk2q6x43b1YBx</span></p><p><b>start</b>: 10453</p><p><b>end</b>: 101770080</p><p><b>method</b>: <span>Vcfeval + Hap.py Comparison</span></p><p><b>truthTP</b>: 7749</p><p><b>truthFN</b>: 2554</p><p><b>queryFP</b>: 10670</p><p><b>gtFP</b>: 2186</p><p><b>precision</b>: 0.428005</p><p><b>recall</b>: 0.752111</p></blockquote><blockquote><p><b>quality</b></p><p><b>type</b>: snp</p><p><b>standardSequence</b>: <span>file-BkZxBZ00bpJVk2q6x43b1YBx</span></p><p><b>start</b>: 10453</p><p><b>end</b>: 101770080</p><p><b>method</b>: <span>Vcfeval + Hap.py Comparison</span></p><p><b>truthTP</b>: 92106</p><p><b>truthFN</b>: 1247</p><p><b>queryFP</b>: 21744</p><p><b>gtFP</b>: 493</p><p><b>precision</b>: 0.808602</p><p><b>recall</b>: 0.986642</p></blockquote><h3>Repositories</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>Url</b></td><td><b>Name</b></td></tr><tr><td>*</td><td>login</td><td><a>https://precision.fda.gov/jobs/job-ByxYPx809jFVy21KJG74Jg3Y</a></td><td>FDA</td></tr></table></div>"
  },
  "coordinateSystem" : 1,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000001.11"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 10453,
    "windowEnd" : 101770080
  },
  "variant" : [
    {
      "start" : 13116,
      "end" : 13117,
      "observedAllele" : "T",
      "referenceAllele" : "G"
    }
  ],
  "quality" : [
    {
      "type" : "indel",
      "standardSequence" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/files/",
            "code" : "file-BkZxBZ00bpJVk2q6x43b1YBx"
          }
        ]
      },
      "start" : 10453,
      "end" : 101770080,
      "method" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/apps/",
            "code" : "app-BxfGF8j02pBZzZxbzZxP725P"
          }
        ],
        "text" : "Vcfeval + Hap.py Comparison"
      },
      "truthTP" : 7749,
      "truthFN" : 2554,
      "queryFP" : 10670,
      "gtFP" : 2186,
      "precision" : 0.428005,
      "recall" : 0.752111
    },
    {
      "type" : "snp",
      "standardSequence" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/files/",
            "code" : "file-BkZxBZ00bpJVk2q6x43b1YBx"
          }
        ]
      },
      "start" : 10453,
      "end" : 101770080,
      "method" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/apps/",
            "code" : "app-BxfGF8j02pBZzZxbzZxP725P"
          }
        ],
        "text" : "Vcfeval + Hap.py Comparison"
      },
      "truthTP" : 92106,
      "truthFN" : 1247,
      "queryFP" : 21744,
      "gtFP" : 493,
      "precision" : 0.808602,
      "recall" : 0.986642
    }
  ],
  "repository" : [
    {
      "type" : "login",
      "url" : "https://precision.fda.gov/jobs/job-ByxYPx809jFVy21KJG74Jg3Y",
      "name" : "FDA"
    }
  ]
}

MolecularSequence "fda-vcf-comparison" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

coordinateSystem: 1

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000001.11watson10453101770080

Variants

-StartEndObservedAlleleReferenceAllele
*1311613117TG

Qualities

-TypeStandardSequenceStartEndScoreMethodTruthTPTruthFNQueryFPGtFPPrecisionFScore
*unknownfile-BkZxBZ00bpJVk2q6x43b1YBx104531017700805.000VCF Comparison1294813168150721860.98850.9823

Repositories

-TypeUrlName
*loginhttps://precision.fda.gov/comparisons/1850FDA

{
  "resourceType" : "MolecularSequence",
  "id" : "fda-vcf-comparison",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.078Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>coordinateSystem</b>: 1</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000001.11</span></td><td>watson</td><td>10453</td><td>101770080</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>13116</td><td>13117</td><td>T</td><td>G</td></tr></table><h3>Qualities</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>StandardSequence</b></td><td><b>Start</b></td><td><b>End</b></td><td><b>Score</b></td><td><b>Method</b></td><td><b>TruthTP</b></td><td><b>TruthFN</b></td><td><b>QueryFP</b></td><td><b>GtFP</b></td><td><b>Precision</b></td><td><b>FScore</b></td></tr><tr><td>*</td><td>unknown</td><td><span>file-BkZxBZ00bpJVk2q6x43b1YBx</span></td><td>10453</td><td>101770080</td><td>5.000</td><td><span>VCF Comparison</span></td><td>129481</td><td>3168</td><td>1507</td><td>2186</td><td>0.9885</td><td>0.9823</td></tr></table><h3>Repositories</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>Url</b></td><td><b>Name</b></td></tr><tr><td>*</td><td>login</td><td><a>https://precision.fda.gov/comparisons/1850</a></td><td>FDA</td></tr></table></div>"
  },
  "coordinateSystem" : 1,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000001.11"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 10453,
    "windowEnd" : 101770080
  },
  "variant" : [
    {
      "start" : 13116,
      "end" : 13117,
      "observedAllele" : "T",
      "referenceAllele" : "G"
    }
  ],
  "quality" : [
    {
      "type" : "unknown",
      "standardSequence" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/files/",
            "code" : "file-BkZxBZ00bpJVk2q6x43b1YBx"
          }
        ]
      },
      "start" : 10453,
      "end" : 101770080,
      "score" : {
        "value" : 5.000
      },
      "method" : {
        "coding" : [
          {
            "system" : "https://precision.fda.gov/apps/",
            "code" : "app-BqB9XZ8006ZZ2g5KzGXP3fpq"
          }
        ],
        "text" : "VCF Comparison"
      },
      "truthTP" : 129481,
      "truthFN" : 3168,
      "queryFP" : 1507,
      "gtFP" : 2186,
      "precision" : 0.9885,
      "fScore" : 0.9823
    }
  ],
  "repository" : [
    {
      "type" : "login",
      "url" : "https://precision.fda.gov/comparisons/1850",
      "name" : "FDA"
    }
  ]
}

MolecularSequence "sequence-complex-variant" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

identifier: id: ?ngen-9? (OFFICIAL)

type: dna

coordinateSystem: 1

specimen: Molecular Specimen ID: MLD45-Z4-1234

device: 12 lead EKG Device Metric

performer: HL7. Generated Summary: name: Health Level Seven International; alias: HL7 International; Phone: (+1) 734-677-7777, Fax: (+1) 734-677-6622, hq@HL7.org

quantity: 25

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12watson128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

readCoverage: 1

Repositories

-TypeDatasetIdReadsetId
*otherEnsemblv1beta2

{
  "resourceType" : "MolecularSequence",
  "id" : "sequence-complex-variant",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:51:17.016Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>identifier</b>: id: ?ngen-9? (OFFICIAL)</p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 1</p><p><b>specimen</b>: <a>Molecular Specimen ID: MLD45-Z4-1234</a></p><p><b>device</b>: <span>12 lead EKG Device Metric</span></p><p><b>performer</b>: <a>HL7. Generated Summary: name: Health Level Seven International; alias: HL7 International; Phone: (+1) 734-677-7777, Fax: (+1) 734-677-6622, hq@HL7.org</a></p><p><b>quantity</b>: 25</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000002.12</span></td><td>watson</td><td>128273724</td><td>128273754</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td><td><b>Cigar</b></td></tr><tr><td>*</td><td>128273724</td><td>128273736</td><td>CTCATTGT</td><td>CTCCATTGCATGCGTT</td><td>3M1D4M6N2M</td></tr></table><p><b>readCoverage</b>: 1</p><h3>Repositories</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>DatasetId</b></td><td><b>ReadsetId</b></td></tr><tr><td>*</td><td>other</td><td>Ensembl</td><td>v1beta2</td></tr></table></div>"
  },
  "identifier" : [
    {
      "use" : "official"
    }
  ],
  "type" : "dna",
  "coordinateSystem" : 1,
  "specimen" : {
    "reference" : "Specimen/genetics-example1-somatic",
    "display" : "Molecular Specimen ID: MLD45-Z4-1234"
  },
  "device" : {
    "display" : "12 lead EKG Device Metric"
  },
  "performer" : {
    "reference" : "Organization/hl7",
    "display" : "HL7"
  },
  "quantity" : {
    "value" : 25
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000002.12"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 128273724,
    "windowEnd" : 128273754
  },
  "variant" : [
    {
      "start" : 128273724,
      "end" : 128273736,
      "observedAllele" : "CTCATTGT",
      "referenceAllele" : "CTCCATTGCATGCGTT",
      "cigar" : "3M1D4M6N2M"
    }
  ],
  "readCoverage" : 1,
  "repository" : [
    {
      "type" : "other",
      "datasetId" : "Ensembl",
      "readsetId" : "v1beta2"
    }
  ]
}

MolecularSequence "example" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

patient: Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25;

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000009.11watson2212550022125510

Variants

-StartEndObservedAlleleReferenceAllele
*2212550322125504CG

Repositories

-TypeUrlNameVariantsetId
*openapihttp://grch37.rest.ensembl.org/ga4gh/variants/3:rs1333049?content-type=application/jsonGA4GH API3:rs1333049

{
  "resourceType" : "MolecularSequence",
  "id" : "example",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:50:35.282Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><p><b>patient</b>: <a>Generated Summary: Medical record number: 12345 (USUAL); active; Peter James Chalmers (OFFICIAL), Jim , Peter James Windsor (MAIDEN); , Phone: (03) 5555 6473, Phone: (03) 3410 5613, Phone: (03) 5555 8834; gender: male; birthDate: 1974-12-25; </a></p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqId</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td><span>NC_000009.11</span></td><td>watson</td><td>22125500</td><td>22125510</td></tr></table><h3>Variants</h3><table><tr><td>-</td><td><b>Start</b></td><td><b>End</b></td><td><b>ObservedAllele</b></td><td><b>ReferenceAllele</b></td></tr><tr><td>*</td><td>22125503</td><td>22125504</td><td>C</td><td>G</td></tr></table><h3>Repositories</h3><table><tr><td>-</td><td><b>Type</b></td><td><b>Url</b></td><td><b>Name</b></td><td><b>VariantsetId</b></td></tr><tr><td>*</td><td>openapi</td><td><a>http://grch37.rest.ensembl.org/ga4gh/variants/3:rs1333049?content-type=application/json</a></td><td>GA4GH API</td><td>3:rs1333049</td></tr></table></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "patient" : {
    "reference" : "Patient/example"
  },
  "referenceSeq" : {
    "referenceSeqId" : {
      "coding" : [
        {
          "system" : "http://www.ncbi.nlm.nih.gov/nuccore",
          "code" : "NC_000009.11"
        }
      ]
    },
    "strand" : "watson",
    "windowStart" : 22125500,
    "windowEnd" : 22125510
  },
  "variant" : [
    {
      "start" : 22125503,
      "end" : 22125504,
      "observedAllele" : "C",
      "referenceAllele" : "G"
    }
  ],
  "repository" : [
    {
      "type" : "openapi",
      "url" : "http://grch37.rest.ensembl.org/ga4gh/variants/3:rs1333049?content-type=application/json",
      "name" : "GA4GH API",
      "variantsetId" : "3:rs1333049"
    }
  ]
}

MolecularSequence "coord-1-base" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 1

ReferenceSeqs

-ReferenceSeqStringStrandWindowStartWindowEnd
*ACGTAGTCwatson18

variant

start: 2

end: 3

observedAllele: ATG

referenceAllele: -

cigar: 3I

variant

start: 5

end: 5

observedAllele: T

referenceAllele: A

cigar: 3I

variant

start: 7

end: 7

observedAllele: -

referenceAllele: T

cigar: 1D

observedSeq: ACATGGTAGC


{
  "resourceType" : "MolecularSequence",
  "id" : "coord-1-base",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:49:36.062Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 1</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqString</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td>ACGTAGTC</td><td>watson</td><td>1</td><td>8</td></tr></table><blockquote><p><b>variant</b></p><p><b>start</b>: 2</p><p><b>end</b>: 3</p><p><b>observedAllele</b>: ATG</p><p><b>referenceAllele</b>: -</p><p><b>cigar</b>: 3I</p></blockquote><blockquote><p><b>variant</b></p><p><b>start</b>: 5</p><p><b>end</b>: 5</p><p><b>observedAllele</b>: T</p><p><b>referenceAllele</b>: A</p><p><b>cigar</b>: 3I</p></blockquote><blockquote><p><b>variant</b></p><p><b>start</b>: 7</p><p><b>end</b>: 7</p><p><b>observedAllele</b>: -</p><p><b>referenceAllele</b>: T</p><p><b>cigar</b>: 1D</p></blockquote><p><b>observedSeq</b>: ACATGGTAGC</p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 1,
  "referenceSeq" : {
    "referenceSeqString" : "ACGTAGTC",
    "strand" : "watson",
    "windowStart" : 1,
    "windowEnd" : 8
  },
  "variant" : [
    {
      "start" : 2,
      "end" : 3,
      "observedAllele" : "ATG",
      "referenceAllele" : "-",
      "cigar" : "3I"
    },
    {
      "start" : 5,
      "end" : 5,
      "observedAllele" : "T",
      "referenceAllele" : "A",
      "cigar" : "3I"
    },
    {
      "start" : 7,
      "end" : 7,
      "observedAllele" : "-",
      "referenceAllele" : "T",
      "cigar" : "1D"
    }
  ],
  "observedSeq" : "ACATGGTAGC"
}

MolecularSequence "coord-0-base" Version "1"

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqStringStrandWindowStartWindowEnd
*ACGTAGTCwatson08

variant

start: 2

end: 2

observedAllele: ATG

referenceAllele: -

cigar: 3I

variant

start: 4

end: 5

observedAllele: T

referenceAllele: A

cigar: 1M

variant

start: 6

end: 7

observedAllele: -

referenceAllele: T

cigar: 1D

observedSeq: ACATGGTAGC


{
  "resourceType" : "MolecularSequence",
  "id" : "coord-0-base",
  "meta" : {
    "versionId" : "1",
    "lastUpdated" : "2021-05-24T10:49:36.019Z",
    "tag" : [
      {
        "system" : "http://terminology.hl7.org/CodeSystem/v3-ActReason",
        "code" : "HTEST",
        "display" : "test health data"
      }
    ]
  },
  "text" : {
    "status" : "generated",
    "div" : "<div xmlns=\"http://www.w3.org/1999/xhtml\"><p><b>Generated Narrative</b></p><p><b>type</b>: dna</p><p><b>coordinateSystem</b>: 0</p><h3>ReferenceSeqs</h3><table><tr><td>-</td><td><b>ReferenceSeqString</b></td><td><b>Strand</b></td><td><b>WindowStart</b></td><td><b>WindowEnd</b></td></tr><tr><td>*</td><td>ACGTAGTC</td><td>watson</td><td>0</td><td>8</td></tr></table><blockquote><p><b>variant</b></p><p><b>start</b>: 2</p><p><b>end</b>: 2</p><p><b>observedAllele</b>: ATG</p><p><b>referenceAllele</b>: -</p><p><b>cigar</b>: 3I</p></blockquote><blockquote><p><b>variant</b></p><p><b>start</b>: 4</p><p><b>end</b>: 5</p><p><b>observedAllele</b>: T</p><p><b>referenceAllele</b>: A</p><p><b>cigar</b>: 1M</p></blockquote><blockquote><p><b>variant</b></p><p><b>start</b>: 6</p><p><b>end</b>: 7</p><p><b>observedAllele</b>: -</p><p><b>referenceAllele</b>: T</p><p><b>cigar</b>: 1D</p></blockquote><p><b>observedSeq</b>: ACATGGTAGC</p></div>"
  },
  "type" : "dna",
  "coordinateSystem" : 0,
  "referenceSeq" : {
    "referenceSeqString" : "ACGTAGTC",
    "strand" : "watson",
    "windowStart" : 0,
    "windowEnd" : 8
  },
  "variant" : [
    {
      "start" : 2,
      "end" : 2,
      "observedAllele" : "ATG",
      "referenceAllele" : "-",
      "cigar" : "3I"
    },
    {
      "start" : 4,
      "end" : 5,
      "observedAllele" : "T",
      "referenceAllele" : "A",
      "cigar" : "1M"
    },
    {
      "start" : 6,
      "end" : 7,
      "observedAllele" : "-",
      "referenceAllele" : "T",
      "cigar" : "1D"
    }
  ],
  "observedSeq" : "ACATGGTAGC"
}