FHIR © HL7.org  |  Server Home  |  Health Intersections FHIR Server v1.0.197  |  FHIR Version 3.0.1  | User: ANONYMOUS (Unknown)  

History Record

XML or JSON representation

Links: First Previous Next Last  (16 found). Search: http://test.fhir.org/r3/Sequence/_history?&_prior=2017-12-17T04:22:05Z&_format=text/xhtml&history-id=93a1c2fa-92fd-4616-961d-f1d7636b1a 

SQL (for debugging): Insert into SearchEntries Select 9197, Ids.ResourceKey, Versions.ResourceVersionKey, RIGHT ('0000000000000'+CAST(Versions.ResourceVersionKey AS VARCHAR(14)),14) as sort, null, null from Versions, Ids, Sessions where Ids.ResourceTypeKey = 104 and Versions.ResourceKey = Ids.ResourceKey and Versions.SessionKey = Sessions.SessionKey order by ResourceVersionKey DESC

Sequence "graphic-example-5" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:23 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: graphic-example-5

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)1128273732128273736

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="graphic-example-5"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:23Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: graphic-example-5</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000002.12
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)</span>
          </td>
          <td>1</td>
          <td>128273732</td>
          <td>128273736</td>
        </tr>
      </table>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000002.12"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="128273732"/>
    <windowEnd value="128273736"/>
  </referenceSeq>
</Sequence>

Sequence "graphic-example-4" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:23 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: graphic-example-4

type: dna

coordinateSystem: 0

ReferenceSeqs

-ChromosomeGenomeBuildStrandWindowStartWindowEnd
*chromosome 2 (Details : {http://hl7.org/fhir/chromosome-human code '2' = 'chromosome 2', given as 'chromosome 2'})GRCh 381128273736128273740

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="graphic-example-4"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:23Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: graphic-example-4</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Chromosome</b>
          </td>
          <td>
            <b>GenomeBuild</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>chromosome 2
            <span>(Details : {http://hl7.org/fhir/chromosome-human code '2' = 'chromosome 2', given as 'chromosome 2'})</span>
          </td>
          <td>GRCh 38</td>
          <td>1</td>
          <td>128273736</td>
          <td>128273740</td>
        </tr>
      </table>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <referenceSeq>
    <chromosome>
      <coding>
        <system value="http://hl7.org/fhir/chromosome-human"/>
        <code value="2"/>
        <display value="chromosome 2"/>
      </coding>
    </chromosome>
    <genomeBuild value="GRCh 38"/>
    <strand value="1"/>
    <windowStart value="128273736"/>
    <windowEnd value="128273740"/>
  </referenceSeq>
</Sequence>

Sequence "graphic-example-3" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:23 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: graphic-example-3

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqPointerStrandWindowStartWindowEnd
*Sequence/graphic-example-51128273732128273736

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*1282737234128273736GAAT2M

pointer: Sequence/graphic-example-4


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="graphic-example-3"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:23Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: graphic-example-3</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqPointer</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>
            <a>Sequence/graphic-example-5</a>
          </td>
          <td>1</td>
          <td>128273732</td>
          <td>128273736</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
          <td>
            <b>Cigar</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>1282737234</td>
          <td>128273736</td>
          <td>GA</td>
          <td>AT</td>
          <td>2M</td>
        </tr>
      </table>
      <p>
        <b>pointer</b>:
        <a>Sequence/graphic-example-4</a>
      </p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <referenceSeq>
    <referenceSeqPointer>
      <reference value="Sequence/graphic-example-5"/>
    </referenceSeqPointer>
    <strand value="1"/>
    <windowStart value="128273732"/>
    <windowEnd value="128273736"/>
  </referenceSeq>
  <variant>
    <start value="1282737234"/>
    <end value="128273736"/>
    <observedAllele value="GA"/>
    <referenceAllele value="AT"/>
    <cigar value="2M"/>
  </variant>
  <pointer>
    <reference value="Sequence/graphic-example-4"/>
  </pointer>
</Sequence>

Sequence "graphic-example-2" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: graphic-example-2

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqStringStrandWindowStartWindowEnd
*CGCCATTG108

pointer: Sequence/graphic-example-3


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="graphic-example-2"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: graphic-example-2</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqString</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>CGCCATTG</td>
          <td>1</td>
          <td>0</td>
          <td>8</td>
        </tr>
      </table>
      <p>
        <b>pointer</b>:
        <a>Sequence/graphic-example-3</a>
      </p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <referenceSeq>
    <referenceSeqString value="CGCCATTG"/>
    <strand value="1"/>
    <windowStart value="0"/>
    <windowEnd value="8"/>
  </referenceSeq>
  <pointer>
    <reference value="Sequence/graphic-example-3"/>
  </pointer>
</Sequence>

Sequence "graphic-example-1" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: graphic-example-1

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)1128273724128273732

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273725128273726GT1M

pointer: Sequence/graphic-example-2


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="graphic-example-1"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: graphic-example-1</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000002.12
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)</span>
          </td>
          <td>1</td>
          <td>128273724</td>
          <td>128273732</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
          <td>
            <b>Cigar</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>128273725</td>
          <td>128273726</td>
          <td>G</td>
          <td>T</td>
          <td>1M</td>
        </tr>
      </table>
      <p>
        <b>pointer</b>:
        <a>Sequence/graphic-example-2</a>
      </p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000002.12"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="128273724"/>
    <windowEnd value="128273732"/>
  </referenceSeq>
  <variant>
    <start value="128273725"/>
    <end value="128273726"/>
    <observedAllele value="G"/>
    <referenceAllele value="T"/>
    <cigar value="1M"/>
  </variant>
  <pointer>
    <reference value="Sequence/graphic-example-2"/>
  </pointer>
</Sequence>

Sequence "example" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: example

type: dna

coordinateSystem: 0

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000009.11 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000009.11' = 'NC_000009.11)12212550022125510

Variants

-StartEndObservedAlleleReferenceAllele
*2212550322125504CG

Repositories

-TypeUrlNameVariantsetId
*openapihttp://grch37.rest.ensembl.org/ga4gh/variants/3:rs1333049?content-type=application/jsonGA4GH API3:rs1333049

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="example"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: example</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000009.11
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000009.11' = 'NC_000009.11)</span>
          </td>
          <td>1</td>
          <td>22125500</td>
          <td>22125510</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>22125503</td>
          <td>22125504</td>
          <td>C</td>
          <td>G</td>
        </tr>
      </table>
      <h3>Repositories</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>Url</b>
          </td>
          <td>
            <b>Name</b>
          </td>
          <td>
            <b>VariantsetId</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>openapi</td>
          <td>
            <a>http://grch37.rest.ensembl.org/ga4gh/variants/3:rs1333049?content-type=application/json</a>
          </td>
          <td>GA4GH API</td>
          <td>3:rs1333049</td>
        </tr>
      </table>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000009.11"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="22125500"/>
    <windowEnd value="22125510"/>
  </referenceSeq>
  <variant>
    <start value="22125503"/>
    <end value="22125504"/>
    <observedAllele value="C"/>
    <referenceAllele value="G"/>
  </variant>
  <repository>
    <type value="openapi"/>
    <url value="http://grch37.rest.ensembl.org/ga4gh/variants/3:rs1333049?content-type=application/json"/>
    <name value="GA4GH API"/>
    <variantsetId value="3:rs1333049"/>
  </repository>
</Sequence>

Sequence "example-TPMT-two" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: example-TPMT-two

type: dna

coordinateSystem: 1

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NT_007592.15 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NT_007592.15' = 'NT_007592.15)11813091818143955

Variants

-StartEndObservedAlleleReferenceAllele
*1813101218131012TC

observedSeq: T-C-T-C-G-C-C-C


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="example-TPMT-two"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: example-TPMT-two</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NT_007592.15
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NT_007592.15' = 'NT_007592.15)</span>
          </td>
          <td>1</td>
          <td>18130918</td>
          <td>18143955</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>18131012</td>
          <td>18131012</td>
          <td>T</td>
          <td>C</td>
        </tr>
      </table>
      <p>
        <b>observedSeq</b>: T-C-T-C-G-C-C-C</p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="1"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NT_007592.15"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="18130918"/>
    <windowEnd value="18143955"/>
  </referenceSeq>
  <variant>
    <start value="18131012"/>
    <end value="18131012"/>
    <observedAllele value="T"/>
    <referenceAllele value="C"/>
  </variant>
  <observedSeq value="T-C-T-C-G-C-C-C"/>
</Sequence>

Sequence "example-TPMT-one" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: example-TPMT-one

type: dna

coordinateSystem: 1

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NT_007592.15 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NT_007592.15' = 'NT_007592.15)11813091818143955

Variants

-StartEndObservedAlleleReferenceAllele
*1813921418139214AG

observedSeq: T-C-C-C-A-C-C-C


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="example-TPMT-one"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: example-TPMT-one</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NT_007592.15
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NT_007592.15' = 'NT_007592.15)</span>
          </td>
          <td>1</td>
          <td>18130918</td>
          <td>18143955</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>18139214</td>
          <td>18139214</td>
          <td>A</td>
          <td>G</td>
        </tr>
      </table>
      <p>
        <b>observedSeq</b>: T-C-C-C-A-C-C-C</p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="1"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NT_007592.15"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="18130918"/>
    <windowEnd value="18143955"/>
  </referenceSeq>
  <variant>
    <start value="18139214"/>
    <end value="18139214"/>
    <observedAllele value="A"/>
    <referenceAllele value="G"/>
  </variant>
  <observedSeq value="T-C-C-C-A-C-C-C"/>
</Sequence>

Sequence "example-pgx-2" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: example-pgx-2

type: dna

coordinateSystem: 0

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NG_007726.3 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NG_007726.3' = 'NG_007726.3)15522797055227980

Variants

-StartEndObservedAlleleReferenceAlleleVariantPointer
*5522797855227979GTTarget Haplotype Observation

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="example-pgx-2"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: example-pgx-2</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NG_007726.3
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NG_007726.3' = 'NG_007726.3)</span>
          </td>
          <td>1</td>
          <td>55227970</td>
          <td>55227980</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
          <td>
            <b>VariantPointer</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>55227978</td>
          <td>55227979</td>
          <td>G</td>
          <td>T</td>
          <td>
            <a>Target Haplotype Observation</a>
          </td>
        </tr>
      </table>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NG_007726.3"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="55227970"/>
    <windowEnd value="55227980"/>
  </referenceSeq>
  <variant>
    <start value="55227978"/>
    <end value="55227979"/>
    <observedAllele value="G"/>
    <referenceAllele value="T"/>
    <variantPointer>
      <reference value="Observation/example-haplotype2"/>
      <display value="Target Haplotype Observation"/>
    </variantPointer>
  </variant>
</Sequence>

Sequence "example-pgx-1" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: example-pgx-1

type: dna

coordinateSystem: 0

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NG_007726.3 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NG_007726.3' = 'NG_007726.3)15522797055227980

Variants

-StartEndObservedAlleleReferenceAlleleVariantPointer
*5522797655227977GTTarget Haplotype Observation

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="example-pgx-1"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: example-pgx-1</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NG_007726.3
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NG_007726.3' = 'NG_007726.3)</span>
          </td>
          <td>1</td>
          <td>55227970</td>
          <td>55227980</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
          <td>
            <b>VariantPointer</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>55227976</td>
          <td>55227977</td>
          <td>G</td>
          <td>T</td>
          <td>
            <a>Target Haplotype Observation</a>
          </td>
        </tr>
      </table>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NG_007726.3"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="55227970"/>
    <windowEnd value="55227980"/>
  </referenceSeq>
  <variant>
    <start value="55227976"/>
    <end value="55227977"/>
    <observedAllele value="G"/>
    <referenceAllele value="T"/>
    <variantPointer>
      <reference value="Observation/example-haplotype1"/>
      <display value="Target Haplotype Observation"/>
    </variantPointer>
  </variant>
</Sequence>

Sequence "fda-example" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: fda-example

type: dna

coordinateSystem: 1

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000001.11 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000001.11' = 'NC_000001.11)110453101770080

Variants

-StartEndObservedAlleleReferenceAllele
*1311613117TG

Qualities

-TypeStandardSequenceStartEndMethodTruthTPQueryTPTruthFNQueryFPGtFPPrecisionRecallFScore
*snpfile-Bk50V4Q0qVb65P0v2VPbfYPZ (Details : {https://precision.fda.gov/files/ code 'file-Bk50V4Q0qVb65P0v2VPbfYPZ' = 'file-Bk50V4Q0qVb65P0v2VPbfYPZ)10453101770080Vcfeval + Hap.py Comparison (Details : {https://precision.fda.gov/jobs/ code 'job-ByxYPx809jFVy21KJG74Jg3Y' = 'job-ByxYPx809jFVy21KJG74Jg3Y)7749798425541067021860.4280050.7521110.545551

Repositories

-TypeUrlNameVariantsetId
*loginhttps://precision.fda.gov/files/file-Bx37ZK009P4bX5g3qjkFZV38FDAfile-Bx37ZK009P4bX5g3qjkFZV38

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="fda-example"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: fda-example</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000001.11
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000001.11' = 'NC_000001.11)</span>
          </td>
          <td>1</td>
          <td>10453</td>
          <td>101770080</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>13116</td>
          <td>13117</td>
          <td>T</td>
          <td>G</td>
        </tr>
      </table>
      <h3>Qualities</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>StandardSequence</b>
          </td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>Method</b>
          </td>
          <td>
            <b>TruthTP</b>
          </td>
          <td>
            <b>QueryTP</b>
          </td>
          <td>
            <b>TruthFN</b>
          </td>
          <td>
            <b>QueryFP</b>
          </td>
          <td>
            <b>GtFP</b>
          </td>
          <td>
            <b>Precision</b>
          </td>
          <td>
            <b>Recall</b>
          </td>
          <td>
            <b>FScore</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>snp</td>
          <td>file-Bk50V4Q0qVb65P0v2VPbfYPZ
            <span>(Details : {https://precision.fda.gov/files/ code 'file-Bk50V4Q0qVb65P0v2VPbfYPZ' = 'file-Bk50V4Q0qVb65P0v2VPbfYPZ)</span>
          </td>
          <td>10453</td>
          <td>101770080</td>
          <td>Vcfeval + Hap.py Comparison
            <span>(Details : {https://precision.fda.gov/jobs/ code 'job-ByxYPx809jFVy21KJG74Jg3Y' = 'job-ByxYPx809jFVy21KJG74Jg3Y)</span>
          </td>
          <td>7749</td>
          <td>7984</td>
          <td>2554</td>
          <td>10670</td>
          <td>2186</td>
          <td>0.428005</td>
          <td>0.752111</td>
          <td>0.545551</td>
        </tr>
      </table>
      <h3>Repositories</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>Url</b>
          </td>
          <td>
            <b>Name</b>
          </td>
          <td>
            <b>VariantsetId</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>login</td>
          <td>
            <a>https://precision.fda.gov/files/file-Bx37ZK009P4bX5g3qjkFZV38</a>
          </td>
          <td>FDA</td>
          <td>file-Bx37ZK009P4bX5g3qjkFZV38</td>
        </tr>
      </table>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="1"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000001.11"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="10453"/>
    <windowEnd value="101770080"/>
  </referenceSeq>
  <variant>
    <start value="13116"/>
    <end value="13117"/>
    <observedAllele value="T"/>
    <referenceAllele value="G"/>
  </variant>
  <quality>
    <type value="snp"/>
    <standardSequence>
      <coding>
        <system value="https://precision.fda.gov/files/"/>
        <code value="file-Bk50V4Q0qVb65P0v2VPbfYPZ"/>
      </coding>
    </standardSequence>
    <start value="10453"/>
    <end value="101770080"/>
    <method>
      <coding>
        <system value="https://precision.fda.gov/jobs/"/>
        <code value="job-ByxYPx809jFVy21KJG74Jg3Y"/>
      </coding>
      <text value="Vcfeval + Hap.py Comparison"/>
    </method>
    <truthTP value="7749"/>
    <queryTP value="7984"/>
    <truthFN value="2554"/>
    <queryFP value="10670"/>
    <gtFP value="2186"/>
    <precision value="0.428005"/>
    <recall value="0.752111"/>
    <fScore value="0.545551"/>
  </quality>
  <repository>
    <type value="login"/>
    <url value="https://precision.fda.gov/files/file-Bx37ZK009P4bX5g3qjkFZV38"/>
    <name value="FDA"/>
    <variantsetId value="file-Bx37ZK009P4bX5g3qjkFZV38"/>
  </repository>
</Sequence>

Sequence "fda-vcfeval-comparison" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:22 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: fda-vcfeval-comparison

coordinateSystem: 1

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000001.11 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000001.11' = 'NC_000001.11)110453101770080

Variants

-StartEndObservedAlleleReferenceAllele
*1311613117TG

quality

type: indel

standardSequence: file-BkZxBZ00bpJVk2q6x43b1YBx (Details : {https://precision.fda.gov/files/ code 'file-BkZxBZ00bpJVk2q6x43b1YBx' = 'file-BkZxBZ00bpJVk2q6x43b1YBx)

start: 10453

end: 101770080

method: Vcfeval + Hap.py Comparison (Details : {https://precision.fda.gov/apps/ code 'app-BxfGF8j02pBZzZxbzZxP725P' = 'app-BxfGF8j02pBZzZxbzZxP725P)

truthTP: 7749

truthFN: 2554

queryFP: 10670

gtFP: 2186

precision: 0.428005

recall: 0.752111

quality

type: snp

standardSequence: file-BkZxBZ00bpJVk2q6x43b1YBx (Details : {https://precision.fda.gov/files/ code 'file-BkZxBZ00bpJVk2q6x43b1YBx' = 'file-BkZxBZ00bpJVk2q6x43b1YBx)

start: 10453

end: 101770080

method: Vcfeval + Hap.py Comparison (Details : {https://precision.fda.gov/apps/ code 'app-BxfGF8j02pBZzZxbzZxP725P' = 'app-BxfGF8j02pBZzZxbzZxP725P)

truthTP: 92106

truthFN: 1247

queryFP: 21744

gtFP: 493

precision: 0.808602

recall: 0.986642

Repositories

-TypeUrlName
*loginhttps://precision.fda.gov/jobs/job-ByxYPx809jFVy21KJG74Jg3YFDA

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="fda-vcfeval-comparison"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:22Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: fda-vcfeval-comparison</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000001.11
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000001.11' = 'NC_000001.11)</span>
          </td>
          <td>1</td>
          <td>10453</td>
          <td>101770080</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>13116</td>
          <td>13117</td>
          <td>T</td>
          <td>G</td>
        </tr>
      </table>
      <blockquote>
        <p>
          <b>quality</b>
        </p>
        <p>
          <b>type</b>: indel</p>
        <p>
          <b>standardSequence</b>: file-BkZxBZ00bpJVk2q6x43b1YBx
          <span>(Details : {https://precision.fda.gov/files/ code 'file-BkZxBZ00bpJVk2q6x43b1YBx' = 'file-BkZxBZ00bpJVk2q6x43b1YBx)</span>
        </p>
        <p>
          <b>start</b>: 10453</p>
        <p>
          <b>end</b>: 101770080</p>
        <p>
          <b>method</b>: Vcfeval + Hap.py Comparison
          <span>(Details : {https://precision.fda.gov/apps/ code 'app-BxfGF8j02pBZzZxbzZxP725P' = 'app-BxfGF8j02pBZzZxbzZxP725P)</span>
        </p>
        <p>
          <b>truthTP</b>: 7749</p>
        <p>
          <b>truthFN</b>: 2554</p>
        <p>
          <b>queryFP</b>: 10670</p>
        <p>
          <b>gtFP</b>: 2186</p>
        <p>
          <b>precision</b>: 0.428005</p>
        <p>
          <b>recall</b>: 0.752111</p>
      </blockquote>
      <blockquote>
        <p>
          <b>quality</b>
        </p>
        <p>
          <b>type</b>: snp</p>
        <p>
          <b>standardSequence</b>: file-BkZxBZ00bpJVk2q6x43b1YBx
          <span>(Details : {https://precision.fda.gov/files/ code 'file-BkZxBZ00bpJVk2q6x43b1YBx' = 'file-BkZxBZ00bpJVk2q6x43b1YBx)</span>
        </p>
        <p>
          <b>start</b>: 10453</p>
        <p>
          <b>end</b>: 101770080</p>
        <p>
          <b>method</b>: Vcfeval + Hap.py Comparison
          <span>(Details : {https://precision.fda.gov/apps/ code 'app-BxfGF8j02pBZzZxbzZxP725P' = 'app-BxfGF8j02pBZzZxbzZxP725P)</span>
        </p>
        <p>
          <b>truthTP</b>: 92106</p>
        <p>
          <b>truthFN</b>: 1247</p>
        <p>
          <b>queryFP</b>: 21744</p>
        <p>
          <b>gtFP</b>: 493</p>
        <p>
          <b>precision</b>: 0.808602</p>
        <p>
          <b>recall</b>: 0.986642</p>
      </blockquote>
      <h3>Repositories</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>Url</b>
          </td>
          <td>
            <b>Name</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>login</td>
          <td>
            <a>https://precision.fda.gov/jobs/job-ByxYPx809jFVy21KJG74Jg3Y</a>
          </td>
          <td>FDA</td>
        </tr>
      </table>
    </div>
  </text>
  <coordinateSystem value="1"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000001.11"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="10453"/>
    <windowEnd value="101770080"/>
  </referenceSeq>
  <variant>
    <start value="13116"/>
    <end value="13117"/>
    <observedAllele value="T"/>
    <referenceAllele value="G"/>
  </variant>
  <quality>
    <type value="indel"/>
    <standardSequence>
      <coding>
        <system value="https://precision.fda.gov/files/"/>
        <code value="file-BkZxBZ00bpJVk2q6x43b1YBx"/>
      </coding>
    </standardSequence>
    <start value="10453"/>
    <end value="101770080"/>
    <method>
      <coding>
        <system value="https://precision.fda.gov/apps/"/>
        <code value="app-BxfGF8j02pBZzZxbzZxP725P"/>
      </coding>
      <text value="Vcfeval + Hap.py Comparison"/>
    </method>
    <truthTP value="7749"/>
    <truthFN value="2554"/>
    <queryFP value="10670"/>
    <gtFP value="2186"/>
    <precision value="0.428005"/>
    <recall value="0.752111"/>
  </quality>
  <quality>
    <type value="snp"/>
    <standardSequence>
      <coding>
        <system value="https://precision.fda.gov/files/"/>
        <code value="file-BkZxBZ00bpJVk2q6x43b1YBx"/>
      </coding>
    </standardSequence>
    <start value="10453"/>
    <end value="101770080"/>
    <method>
      <coding>
        <system value="https://precision.fda.gov/apps/"/>
        <code value="app-BxfGF8j02pBZzZxbzZxP725P"/>
      </coding>
      <text value="Vcfeval + Hap.py Comparison"/>
    </method>
    <truthTP value="92106"/>
    <truthFN value="1247"/>
    <queryFP value="21744"/>
    <gtFP value="493"/>
    <precision value="0.808602"/>
    <recall value="0.986642"/>
  </quality>
  <repository>
    <type value="login"/>
    <url value="https://precision.fda.gov/jobs/job-ByxYPx809jFVy21KJG74Jg3Y"/>
    <name value="FDA"/>
  </repository>
</Sequence>

Sequence "fda-vcf-comparison" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:21 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: fda-vcf-comparison

coordinateSystem: 1

patient: Patient/example

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000001.11 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000001.11' = 'NC_000001.11)110453101770080

Variants

-StartEndObservedAlleleReferenceAllele
*1311613117TG

Qualities

-TypeStandardSequenceStartEndScoreMethodTruthTPTruthFNQueryFPGtFPPrecisionFScore
*unknownfile-BkZxBZ00bpJVk2q6x43b1YBx (Details : {https://precision.fda.gov/files/ code 'file-BkZxBZ00bpJVk2q6x43b1YBx' = 'file-BkZxBZ00bpJVk2q6x43b1YBx)104531017700805.000VCF Comparison (Details : {https://precision.fda.gov/apps/ code 'app-BqB9XZ8006ZZ2g5KzGXP3fpq' = 'app-BqB9XZ8006ZZ2g5KzGXP3fpq)1294813168150721860.98850.9823

Repositories

-TypeUrlName
*loginhttps://precision.fda.gov/comparisons/1850FDA

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="fda-vcf-comparison"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:21Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: fda-vcf-comparison</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <p>
        <b>patient</b>:
        <a>Patient/example</a>
      </p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000001.11
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000001.11' = 'NC_000001.11)</span>
          </td>
          <td>1</td>
          <td>10453</td>
          <td>101770080</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>13116</td>
          <td>13117</td>
          <td>T</td>
          <td>G</td>
        </tr>
      </table>
      <h3>Qualities</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>StandardSequence</b>
          </td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>Score</b>
          </td>
          <td>
            <b>Method</b>
          </td>
          <td>
            <b>TruthTP</b>
          </td>
          <td>
            <b>TruthFN</b>
          </td>
          <td>
            <b>QueryFP</b>
          </td>
          <td>
            <b>GtFP</b>
          </td>
          <td>
            <b>Precision</b>
          </td>
          <td>
            <b>FScore</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>unknown</td>
          <td>file-BkZxBZ00bpJVk2q6x43b1YBx
            <span>(Details : {https://precision.fda.gov/files/ code 'file-BkZxBZ00bpJVk2q6x43b1YBx' = 'file-BkZxBZ00bpJVk2q6x43b1YBx)</span>
          </td>
          <td>10453</td>
          <td>101770080</td>
          <td>5.000</td>
          <td>VCF Comparison
            <span>(Details : {https://precision.fda.gov/apps/ code 'app-BqB9XZ8006ZZ2g5KzGXP3fpq' = 'app-BqB9XZ8006ZZ2g5KzGXP3fpq)</span>
          </td>
          <td>129481</td>
          <td>3168</td>
          <td>1507</td>
          <td>2186</td>
          <td>0.9885</td>
          <td>0.9823</td>
        </tr>
      </table>
      <h3>Repositories</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>Url</b>
          </td>
          <td>
            <b>Name</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>login</td>
          <td>
            <a>https://precision.fda.gov/comparisons/1850</a>
          </td>
          <td>FDA</td>
        </tr>
      </table>
    </div>
  </text>
  <coordinateSystem value="1"/>
  <patient>
    <reference value="Patient/example"/>
  </patient>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000001.11"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="10453"/>
    <windowEnd value="101770080"/>
  </referenceSeq>
  <variant>
    <start value="13116"/>
    <end value="13117"/>
    <observedAllele value="T"/>
    <referenceAllele value="G"/>
  </variant>
  <quality>
    <type value="unknown"/>
    <standardSequence>
      <coding>
        <system value="https://precision.fda.gov/files/"/>
        <code value="file-BkZxBZ00bpJVk2q6x43b1YBx"/>
      </coding>
    </standardSequence>
    <start value="10453"/>
    <end value="101770080"/>
    <score>
      <value value="5.000"/>
    </score>
    <method>
      <coding>
        <system value="https://precision.fda.gov/apps/"/>
        <code value="app-BqB9XZ8006ZZ2g5KzGXP3fpq"/>
      </coding>
      <text value="VCF Comparison"/>
    </method>
    <truthTP value="129481"/>
    <truthFN value="3168"/>
    <queryFP value="1507"/>
    <gtFP value="2186"/>
    <precision value="0.9885"/>
    <fScore value="0.9823"/>
  </quality>
  <repository>
    <type value="login"/>
    <url value="https://precision.fda.gov/comparisons/1850"/>
    <name value="FDA"/>
  </repository>
</Sequence>

Sequence "sequence-complex-variant" Version "1"

Created by SYSTEM () at 11/28/2017 8:36:21 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: sequence-complex-variant

identifier: ?? (OFFICIAL)

type: dna

coordinateSystem: 1

specimen: Molecular Specimen ID: MLD45-Z4-1234

device: 12 lead EKG Device Metric

performer: HL7

quantity: 25

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)1128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

readCoverage: 1

Repositories

-TypeDatasetIdReadsetId
*otherEnsemblv1beta2

<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="sequence-complex-variant"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:36:21Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: sequence-complex-variant</p>
      <p>
        <b>identifier</b>: ?? (OFFICIAL)</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <p>
        <b>specimen</b>:
        <a>Molecular Specimen ID: MLD45-Z4-1234</a>
      </p>
      <p>
        <b>device</b>: 12 lead EKG Device Metric</p>
      <p>
        <b>performer</b>:
        <a>HL7</a>
      </p>
      <p>
        <b>quantity</b>: 25</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqId</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>NC_000002.12
            <span>(Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)</span>
          </td>
          <td>1</td>
          <td>128273724</td>
          <td>128273754</td>
        </tr>
      </table>
      <h3>Variants</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Start</b>
          </td>
          <td>
            <b>End</b>
          </td>
          <td>
            <b>ObservedAllele</b>
          </td>
          <td>
            <b>ReferenceAllele</b>
          </td>
          <td>
            <b>Cigar</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>128273724</td>
          <td>128273736</td>
          <td>CTCATTGT</td>
          <td>CTCCATTGCATGCGTT</td>
          <td>3M1D4M6N2M</td>
        </tr>
      </table>
      <p>
        <b>readCoverage</b>: 1</p>
      <h3>Repositories</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>Type</b>
          </td>
          <td>
            <b>DatasetId</b>
          </td>
          <td>
            <b>ReadsetId</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>other</td>
          <td>Ensembl</td>
          <td>v1beta2</td>
        </tr>
      </table>
    </div>
  </text>
  <identifier>
    <use value="official"/>
  </identifier>
  <type value="dna"/>
  <coordinateSystem value="1"/>
  <specimen>
    <reference value="Specimen/genetics-example1-somatic"/>
    <display value="Molecular Specimen ID: MLD45-Z4-1234"/>
  </specimen>
  <device>
    <display value="12 lead EKG Device Metric"/>
  </device>
  <performer>
    <reference value="Organization/hl7"/>
    <display value="HL7"/>
  </performer>
  <quantity>
    <value value="25"/>
  </quantity>
  <referenceSeq>
    <referenceSeqId>
      <coding>
        <system value="http://www.ncbi.nlm.nih.gov/nuccore"/>
        <code value="NC_000002.12"/>
      </coding>
    </referenceSeqId>
    <strand value="1"/>
    <windowStart value="128273724"/>
    <windowEnd value="128273754"/>
  </referenceSeq>
  <variant>
    <start value="128273724"/>
    <end value="128273736"/>
    <observedAllele value="CTCATTGT"/>
    <referenceAllele value="CTCCATTGCATGCGTT"/>
    <cigar value="3M1D4M6N2M"/>
  </variant>
  <readCoverage value="1"/>
  <repository>
    <type value="other"/>
    <datasetId value="Ensembl"/>
    <readsetId value="v1beta2"/>
  </repository>
</Sequence>

Sequence "coord-1-base" Version "1"

Created by SYSTEM () at 11/28/2017 8:28:28 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: coord-1-base

type: dna

coordinateSystem: 1

ReferenceSeqs

-ReferenceSeqStringStrandWindowStartWindowEnd
*ACGTAGTC118

variant

start: 2

end: 3

observedAllele: ATG

referenceAllele: -

cigar: 3I

variant

start: 5

end: 5

observedAllele: T

referenceAllele: A

cigar: 3I

variant

start: 7

end: 7

observedAllele: -

referenceAllele: T

cigar: 1D

observedSeq: ACATGGTAGC


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="coord-1-base"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:28:28Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: coord-1-base</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 1</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqString</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>ACGTAGTC</td>
          <td>1</td>
          <td>1</td>
          <td>8</td>
        </tr>
      </table>
      <blockquote>
        <p>
          <b>variant</b>
        </p>
        <p>
          <b>start</b>: 2</p>
        <p>
          <b>end</b>: 3</p>
        <p>
          <b>observedAllele</b>: ATG</p>
        <p>
          <b>referenceAllele</b>: -</p>
        <p>
          <b>cigar</b>: 3I</p>
      </blockquote>
      <blockquote>
        <p>
          <b>variant</b>
        </p>
        <p>
          <b>start</b>: 5</p>
        <p>
          <b>end</b>: 5</p>
        <p>
          <b>observedAllele</b>: T</p>
        <p>
          <b>referenceAllele</b>: A</p>
        <p>
          <b>cigar</b>: 3I</p>
      </blockquote>
      <blockquote>
        <p>
          <b>variant</b>
        </p>
        <p>
          <b>start</b>: 7</p>
        <p>
          <b>end</b>: 7</p>
        <p>
          <b>observedAllele</b>: -</p>
        <p>
          <b>referenceAllele</b>: T</p>
        <p>
          <b>cigar</b>: 1D</p>
      </blockquote>
      <p>
        <b>observedSeq</b>: ACATGGTAGC</p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="1"/>
  <referenceSeq>
    <referenceSeqString value="ACGTAGTC"/>
    <strand value="1"/>
    <windowStart value="1"/>
    <windowEnd value="8"/>
  </referenceSeq>
  <variant>
    <start value="2"/>
    <end value="3"/>
    <observedAllele value="ATG"/>
    <referenceAllele value="-"/>
    <cigar value="3I"/>
  </variant>
  <variant>
    <start value="5"/>
    <end value="5"/>
    <observedAllele value="T"/>
    <referenceAllele value="A"/>
    <cigar value="3I"/>
  </variant>
  <variant>
    <start value="7"/>
    <end value="7"/>
    <observedAllele value="-"/>
    <referenceAllele value="T"/>
    <cigar value="1D"/>
  </variant>
  <observedSeq value="ACATGGTAGC"/>
</Sequence>

Sequence "coord-0-base" Version "1"

Created by SYSTEM () at 11/28/2017 8:28:28 AM(UTC)

Tags: (no tags)  +

This Resource , XML or JSON representation, or the full version history.. provenance for this resource
Updated: by

Generated Narrative with Details

id: coord-0-base

type: dna

coordinateSystem: 0

ReferenceSeqs

-ReferenceSeqStringStrandWindowStartWindowEnd
*ACGTAGTC108

variant

start: 2

end: 2

observedAllele: ATG

referenceAllele: -

cigar: 3I

variant

start: 4

end: 5

observedAllele: T

referenceAllele: A

cigar: 1M

variant

start: 6

end: 7

observedAllele: -

referenceAllele: T

cigar: 1D

observedSeq: ACATGGTAGC


<?xml version="1.0" encoding="UTF-8"?>
<Sequence xmlns="http://hl7.org/fhir">
  <id value="coord-0-base"/>
  <meta>
    <versionId value="1"/>
    <lastUpdated value="2017-11-28T08:28:28Z"/>
  </meta>
  <text>
    <status value="generated"/>
    <div xmlns="http://www.w3.org/1999/xhtml">
      <p>
        <b>Generated Narrative with Details</b>
      </p>
      <p>
        <b>id</b>: coord-0-base</p>
      <p>
        <b>type</b>: dna</p>
      <p>
        <b>coordinateSystem</b>: 0</p>
      <h3>ReferenceSeqs</h3>
      <table>
        <tr>
          <td>-</td>
          <td>
            <b>ReferenceSeqString</b>
          </td>
          <td>
            <b>Strand</b>
          </td>
          <td>
            <b>WindowStart</b>
          </td>
          <td>
            <b>WindowEnd</b>
          </td>
        </tr>
        <tr>
          <td>*</td>
          <td>ACGTAGTC</td>
          <td>1</td>
          <td>0</td>
          <td>8</td>
        </tr>
      </table>
      <blockquote>
        <p>
          <b>variant</b>
        </p>
        <p>
          <b>start</b>: 2</p>
        <p>
          <b>end</b>: 2</p>
        <p>
          <b>observedAllele</b>: ATG</p>
        <p>
          <b>referenceAllele</b>: -</p>
        <p>
          <b>cigar</b>: 3I</p>
      </blockquote>
      <blockquote>
        <p>
          <b>variant</b>
        </p>
        <p>
          <b>start</b>: 4</p>
        <p>
          <b>end</b>: 5</p>
        <p>
          <b>observedAllele</b>: T</p>
        <p>
          <b>referenceAllele</b>: A</p>
        <p>
          <b>cigar</b>: 1M</p>
      </blockquote>
      <blockquote>
        <p>
          <b>variant</b>
        </p>
        <p>
          <b>start</b>: 6</p>
        <p>
          <b>end</b>: 7</p>
        <p>
          <b>observedAllele</b>: -</p>
        <p>
          <b>referenceAllele</b>: T</p>
        <p>
          <b>cigar</b>: 1D</p>
      </blockquote>
      <p>
        <b>observedSeq</b>: ACATGGTAGC</p>
    </div>
  </text>
  <type value="dna"/>
  <coordinateSystem value="0"/>
  <referenceSeq>
    <referenceSeqString value="ACGTAGTC"/>
    <strand value="1"/>
    <windowStart value="0"/>
    <windowEnd value="8"/>
  </referenceSeq>
  <variant>
    <start value="2"/>
    <end value="2"/>
    <observedAllele value="ATG"/>
    <referenceAllele value="-"/>
    <cigar value="3I"/>
  </variant>
  <variant>
    <start value="4"/>
    <end value="5"/>
    <observedAllele value="T"/>
    <referenceAllele value="A"/>
    <cigar value="1M"/>
  </variant>
  <variant>
    <start value="6"/>
    <end value="7"/>
    <observedAllele value="-"/>
    <referenceAllele value="T"/>
    <cigar value="1D"/>
  </variant>
  <observedSeq value="ACATGGTAGC"/>
</Sequence>